Javascript is currently disabled in your browser. When javascript is disabled, some functions of this website will not work.

Open access for scientific and medical research

From submission to the first editing decision.

From editor acceptance to publication.

The above percentage of manuscripts have been rejected in the past 12 months.

Open access to peer-reviewed scientific and medical journals.

Dove Medical Press is a member of OAI.

Batch reprints for the pharmaceutical industry.

We provide real benefits for authors, including fast processing of papers.

Register your specific details and specific drugs of interest, and we will match the information you provide with articles in our extensive database and send you a PDF copy via email in a timely manner.

Back to Journal »International Journal of Nanomedicine» Volume 12

Author Alarifi S, Ali H, Alkahtani S, Alessia MS

Published on June 21, 2017, the 2017 volume: 12 pages 4541-4551

DOI https://doi.org/10.2147/IJN.S139326

Single anonymous peer review

Editor approved for publication: Dr. Thomas J Webster

Saud Alarifi, 1 Huma Ali, 2 Saad Alkahtani, 1 Mohammed S Alessia 3 1 Department of Zoology, Faculty of Science, King Saud University, Riyadh, Saudi Arabia; 2 Department of Chemistry, Maulana Azad National Institute of Technology, Bhopal, Member of Parliament, India; 3 Department of Biology, Faculty of Science, Al-Imam Muhammad Ibn Saud Islamic University, Riyadh, Saudi Arabia Abstract: Gadolinium oxide (Gd2O3) nanoparticles (GNP) are used in industrial products such as additives, optical glasses and catalysts. There are many suggestions for the metal nanoparticle paradigm, but the underlying underlying mechanism of the toxicity of metal nanoparticles (such as GNP) remains unclear. This experiment aims to measure the effective toxicity of GNP (10, 25, 50 and 100 µg/mL) within 24 and 48 hours, and to evaluate the toxicity mechanism of human neuron (SH-SY5Y) cells. GNP generates reactive oxygen species (ROS), as assessed by 2', 7'-dichlorodihydrofluorescein diacetate. Due to incorporation into cells, GNP generates ROS in a concentration and time dependent manner. In order to determine the toxicity of the GNP mechanism associated with ROS, we also found chromosome condensation and mitochondrial membrane potential (MMP) dysfunction after GNP exposure. In addition, the increased rate of apoptosis and DNA fragmentation are closely related to the increase in GNPs dose and exposure time in SH-SY5Y cells. The decrease in MMP and the increase in the expression of the bax/bcl2 gene ratio indicate that the mitochondrial-mediated pathway is involved in GNPs-induced apoptosis. Therefore, our findings provide valuable insights into the possible mechanism of GNP-induced apoptosis at the in vitro level. Keywords: GNPs, SH-SY5Y cells, apoptosis, ROS, DNA fragmentation

The advancement of engineered nanostructures with fine size and shape control, the elucidation of their unique properties, and the demonstration of their wide range of applications make nanotechnology an exciting research field. 1,2 Engineered nanoparticles are used as probes for ultra-sensitive molecular sensing and diagnostic imaging, for photodynamic therapy and actuators for drug delivery, triggers for photothermal treatment, and for the construction of solar cells, Precursors for electronic devices and light-emitting diodes. 1,3 Gadolinium oxide (Gd2O3) nanoparticles (GNP) have huge biomedical applications at the molecular level and are used as contrast materials in magnetic imaging. Hedlund et al. 4 reported that GNP is used as a contrast agent in magnetic resonance imaging (MRI) of hematopoietic cells. As an important high-resolution non-radioactive surgery, MRI has become a routine diagnostic tool in clinical medicine recently. MRI is a popular technique because of its low price, lowest radiation exposure, and its ability to provide a wide range of anatomical information. 5 Dixit et al.6 reported that Gd2O3 contains a large number of unpaired electrons, which makes it an attractive T1-weighted MRI contrast agent. Gadolinium chelate induces potential toxicity, such as renal fibrosis. 7 In this regard, effective in vivo nanoparticle toxicity assays must be developed to avoid loss or reduction of toxicity in vitro. 8 Babic-Stojic et al. 9 reported that GNP induces a potentially toxic mouse fibrosarcoma cell line L929. Nevertheless, the use of nano-sized particles will increase environmental and human exposure, as well as the effective risks associated with their toxicity. Due to the metallic properties of metal-derived nanoparticles and the presence of transition metals, the production of reactive oxygen species (ROS) will be induced, leading to oxidative stress. 10,11 Hanahan and Weinberg12 reported that after nanoparticles activate stress in cells, it is important for cells to perform adverse reactions or produce apoptosis to reduce cell damage.

Mitochondria are high-energy organelles in living cells, involved in differentiation and energy supply. There is an important relationship between the production of ROS and mitochondria. The structural damage of mitochondria can produce irregular cellular ROS stability. In addition, additional ROS production can cause mitochondrial damage. Unfried et al. 13 reported that mitochondria are the main cellular components and can be harmfully affected by the toxicity of nanoparticles. In this study, we evaluated the potential ability of GNPs to induce oxidative stress and DNA single-strand breaks, and their possible relationship with the cytotoxicity of human neuron (SH-SY5Y) cells.

GNP (average particle size <100 nm particle size, 99.8% trace metal basis), penicillin, streptomycin, 3-(4, 5-dimethyl-2-thiazolyl)-2, 5-diphenyl-2H -Bromotetrazole (MTT), 2,7-dichlorodihydrofluorescein diacetate (H2-DCFDA) and Hoechst 33258 were purchased from Sigma-Aldrich (St. Louis, Missouri, USA). Dulbecco's Modified Eagle's medium cell culture medium was obtained from Gibco BRL (Grand Island, NY, USA).

According to product information, the particle size of GNP (Sigma, Cat-No 637335) is less than 100 nm. In order to confirm and further clarify the shape and size of GNP, transmission electron microscopy (TEM, JEM-2010; Applied Chemistry and Morphological Analysis Laboratory, Horton, Michigan, USA) and dynamic light scattering (DLS, Zetasizer Nano; Malvern, Woos) County, United Kingdom)) is used. GNP was prepared in a stock suspension (1 mg/mL) in deionized water, and sonicated with an Elmasonic S30H sonicator (Elma, Germany). The hydrodynamic diameter and zeta potential of GNP in water and culture medium were measured by DLS.

Human neuron (SH-SY5Y) cells were purchased from the American Type Culture Collection (ATCC® CRL.2266™). The cells were subcultured in Dulbecco's modified essential medium containing 10% fetal bovine serum and 5% CO2 at 37°C.

An inverted microscope (Leica DM IL) was used to observe the morphology of SH-SY5Y cells 24 and 48 hours after GNP exposure.

As mentioned earlier, the MTT activity test was performed with slight modifications. Inoculate 14 SH-SY5Y cells in a culture plate (96 wells and 1×104 cells per well), and incubate overnight at 37°C in a 5% CO2 incubator. The cells were treated with GNP (10, 25, 50, and 100 μg/mL) for 24 and 48 hours, and then incubated with MTT for 4 hours. After removing the medium, add 100 μL of dimethyl sulfoxide (DMSO) to dissolve the formazan crystals. Determine the number of viable cells in each well by using a microplate spectrophotometer to quantify the absorbance at 570 nm with a reference wavelength of 630 nm. All experiments were performed 3 times, and each experiment was repeated 5 times.

The cytotoxicity of GNP is measured by the leakage of lactate dehydrogenase (LDH) into the culture medium. After processing the GNP, extract the medium and centrifuge at 3,000 rpm for 5 minutes to obtain a cell-free supernatant.

The Cayman Chemical Kit (Cat. No. 601170) was used to measure the LDH activity in the culture medium. The test is based on the change in lactate pyruvate in the presence of LDH and the parallel reduction of nicotinamide adenine dinucleotide. The nicotinamide adenine dinucleotide hydride produced by the reaction causes a change in absorbance at 340 nm. The supernatant medium and hot reagent are mixed in a 96-well plate, and the absorbance is recorded using a microplate spectrophotometer system. The data is analyzed and expressed as a percentage of the control value.

The formation of intracellular ROS was measured using the dichlorodihydrofluorescein diacetate method. 15 After GNP was exposed to SH-SY5Y cells, the production of intracellular ROS was measured by H2-DCFDA. DCFDA is a cell permeability demonstrator of ROS. ROS will not fluoresce until the acetate group is cleared by intracellular esterase and oxidation occurs in the cell. In short, prepare a 10 mM H2-DCFDA stock solution in DMSO in the culture medium to produce a 5 μM working solution. After incubating for 1 hour at room temperature, SH-SY5Y cells were washed twice with pre-warmed phosphate buffered saline (PBS) and fixed with paraformaldehyde (4%). The fluorescence of SH-SY5Y cells treated with GNP was evaluated by the fluorescence of an upright microscope (Nikon Eclipse 80i).

SH-SY5Y cells (104 cells/well) were cultured in a black-bottomed culture plate (96-well) and treated with GNP for 48 hours. After treatment, SH-SY5Y cells were kept with H2-DCFH-DA (5 mM) for 1 hour.

To evaluate the protective effect of N-acetylcysteine ​​(NAC), SH-SY5Y cells were pretreated with NAC (1.5 mM) at 37°C for 1 hour, and then combined with GNP (100 μg/mL) at 37°C Incubate for 24 and 48 hours. Measure the relative fluorescence intensity of the cell suspension. The excitation wavelength and barrier wavelength are 485 and 528 nm, respectively. The results are expressed as a percentage of the fluorescence intensity of the control wells.

Mitochondrial membrane potential analysis

The measurement of mitochondrial membrane potential (MMP) was carried out in accordance with the protocol of Zhang et al. 16 In short, control and treated cells were harvested and washed twice with PBS. The cells were further exposed to 10 mg/mL rhodamine-123 fluorescent dye for 1 hour in the dark at 37°C. The cells were washed twice with PBS again. Then, use an upright fluorescence microscope (OLYMPUS CKX 41) to measure the fluorescence intensity of Rhodamine 123 by capturing images at 20 times magnification.

After treating GNPs (10, 25, 50, and 100 μg/mL) for 24 and 48 hours, they were washed with frozen PBS and lysed with frozen RIPA buffer (phenylmethylsulfonyl fluoride and phosphatase inhibitor) for 30 minutes. The lysate of SH-SY5Y cells was centrifuged at 12,000 rpm for 10 minutes at 4°C, and the supernatant was collected for the determination of malondialdehyde (MDA) lipid peroxide (LPO), glutathione (GSH), Superoxide dismutase (SOD), and catalase (CAT) activities. The Bradford method was used to quantify the protein concentration of the cell lysate. 20 All observations were performed using Cayman Chemical kits for MDA (item number 705002), GSH (item number 703002), SOD (item number 706002) and CAT (item number) No 707002) (Cayman Chemical, Ann Arbor, MI, USA) According to the manufacturer's instructions.

Apoptosis by Hoechst 33258 staining and caspase-3 activity

Hoechst 33258 probe cells are used to find apoptotic cells. After exposure to GNP (10, 25, 50, and 100 μg/mL) for 24 and 48 hours, the cells were fixed with paraformaldehyde (4%) for 30 minutes, and then incubated with DNA staining Hoechst 33258 dye in the dark 15 Minutes at room temperature. After incubation, observe the cells under a fluorescence microscope with excitation (350 nm)/emission (460 nm) spectra.

The activity of caspase-3 is determined by the cleavage of caspase-3 substrate I (N-acetyl-DEVD-p-nitroaniline). P-Nitroaniline is used as a standard. The cleavage of the substrate is monitored at 405 nm, and the specific activity is expressed in picomoles of product (nitroaniline) per minute/mg protein.

Comet test (microgel electrophoresis test)

As described by Singh et al., the alkaline comet assay was used. 17 In short, 50,000 cells (per well) are seeded in a six-well plate. After 24 hours, the cells were treated with GNP for 24 and 48 hours. Before the comet assay​​, the cell viability of all cell samples were determined by the trypan blue exclusion method. 18 Cell viability is always about 85%. Suspend 20 microliters of cells in 0.5% low melting point (LMP) agarose (Sigma-Aldrich, St Louis, MO, USA), and pipette onto a super frosted glass slide pre-coated with 1% normal melting point. Spot agarose (Sigma-Aldrich), spread it with a cover glass, and keep it at 4°C for 5 minutes to solidify. All slides were covered with a third layer of 0.5% LMP agarose and solidified again on ice for 5 minutes. After removing the cover glass, place the slide in the cold lysis solution (2.5 M NaCl, 100 mM EDTA, 10 mM Tris, 1% Triton X-100 and 10% dimethyl sulfoxide, pH 10, adjusted with NaOH) Incubate at 4°C overnight, and then perform electrophoresis and staining with ethidium bromide (20 μg/mL) as described by Singh et al. An image analysis system (Komet 4.0; Kinetic Imaging, Liverpool, UK) connected to a microscope (DMLB; Leica, Germany) was used to score the slides at a final magnification of 40 times. The microscope was equipped with a CCD camera with fluorescence attachment. The comet parameters used to measure DNA damage in cells are olive tail moment and tail DNA (%). Analyze the images of 100 random cells (50 per replicate slide) for each experiment according to the guide. 19

Cell lysis reagent (CelLytic™ M, Sigma-Aldrich) was used to precipitate and lyse cells treated with GNP in the presence of a mixture of sodium orthovanadate, sodium fluoride and protease inhibitors. The total protein concentration was measured by Bradford method 20, and bovine serum albumin was used as the standard. The protein (40 μg/lane) was separated by sodium lauryl sulfate-polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane. The membrane was blocked with 5% skimmed milk at room temperature for 1.5 hours, and probed with anti-human primary antibodies (1:1,000) against β-actin, Bcl2 and Bax (Cell Signaling Technology, Danvers, MA, USA) for 1 h at room temperature And then incubate overnight at 4°C. Then the membrane was incubated with the primary antibody of the secondary antibody coupled with horseradish peroxidase (Calbiochem, Billerica, MA, USA) at room temperature for 1.5 hours. The protein bands were observed by enhanced chemiluminescence (Super Signal West Pico chemiluminescence reagent; Pierce, Rockford, IL, USA), and the optical density was measured using the Scion Image program (Scion Corporation, Fredrick, MD, USA). β-actin was used as a protein loading control.

Real-time polymerase chain reaction analysis

Use TRIzol reagent (Invitrogen, Carlsbad, CA, USA) to lyse SH-SY5Y cells (2×106 in 60 mm culture plate) treated with GNP (100 μg/mL) and extract total RNA. The purity and concentration of the isolated RNA were determined by a nanodrop spectrophotometer (ND-1000; Thermo Scientific, South San Francisco, CA, USA) at an absorbance of 260 nm. RNA samples are stored at -20°C. For real-time polymerase chain reaction (RT-PCR), complementary DNA (cDNA) is synthesized using a high-capacity cDNA reverse transcription kit (Sigma-Aldrich). According to the manufacturer's instructions, the apoptotic genes Bax-TCTGACGGCAACTTCAACTG, TTGAGGAGTCTCACCCAACC and Bcl2-GGATGCCTTTGTGGAACTGT, AGCCTGCAGCTTTGTTTCAT were used to perform RT-PCR relative quantification using the Applied Biosystems Sequence Detection System (PE Applied Biosystems, Foster City, CA, USA). RT-PCR consists of 40 cycles of initial denaturation at 95°C for 10 minutes, 95°C for 15 seconds, and 50°C for 1 minute. Each sample was tested in triplicate, the cycle threshold (CT) value was standardized according to the housekeeping gene GAPDH, and the 21CT method was used to calculate the fold change. twenty one

The analysis adopts the analysis of variance test. * P<0.01 compared with the corresponding control, and between the GNP (100 μg/mL) and GNP (100 μg/mL) + NAC groups at different concentrations in the same duration were considered significant. For statistical analysis, we conducted at least 3 independent experiments.

The TEM average diameter is calculated by measuring more than 100 particles in a random field in the TEM view. The average TEM diameter of GNP is also ~36.70±2.30 nm (Figure 1). The average hydrodynamic size of GNP in water and cell culture medium determined by DLS is about 120±14.50 and 92.5±19.04 nm, respectively. In addition, the zeta potentials of GNP in water and medium are ~13.2 and 20.55 mV, respectively. The physical and chemical properties of GNPs are listed in Table 1.

Figure 1 Characterization of GNP (A). TEM image (B). Size distribution (%) of GNP generated from TEM image. Abbreviations: GNP, gadolinium oxide nanoparticles; TEM, transmission electron microscope.

Table 1 Physical and chemical properties of gadolinium oxide nanoparticles

The effect of GNPs on the viability and morphology of SH-SY5Y cells

SH-SY5Y cells were exposed to GNP at concentrations of 0, 10, 25, 50, and 100 μg/mL for 24 and 48 hours, and MTT and LDH assays were used to determine cytotoxicity. The results showed that GNPs significantly reduced cell viability in a dose- and time-dependent manner. In the MTT assay, the cell survival rate dropped to 97.6%, 86.9%, 72.43%, and 62.7% within 24 hours (Figure 2A), and to 95.2%, 81.01%, 63.3%, and 46.06% within 48 hours ( Figure 2B) Exposure to GNP at concentrations of 10, 25, 50, and 100 μ/mL. Figure 2C and D show the cytotoxicity results obtained by the LDH assay. In the LDH assay, when cells are exposed to concentrations of 10, 25, 50, and 100 μg/mL, respectively. Both assays showed similar concentration and duration-dependent cytotoxicity of GNP. Based on the cell viability data of the inverted microscope, the results also showed that due to GNP exposure (Figure 3B and C), cell density and cell rounding decreased in a dose- and time-dependent manner.

Figure 2 The morphology of SH-SY5Y cells. (A) Control cells (B) 24 hours after exposure to 100 μg/mL GNP, (C) 48 hours after exposure to 100 μg/mL GNP. The arrow (→) indicates damaged SH-SY5Y cells. The scale bar is 50 μm. Abbreviation: GNP, gadolinium oxide nanoparticles.

Figure 3 MTT assay (A, B) and LDH leakage (C, D) in SH-SY5Y cells exposed to gadolinium oxide nanoparticles for 24 and 48 hours. Data are expressed as mean ± SE. * P<0.01 compared with control. Abbreviations: LDH, lactate dehydrogenase; MTT, 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide; SE, standard error.

ROS generation in SH-SY5Y cells

In order to evaluate the cytosolic ROS produced by GNP, we exposed GNP to SH-SY5Y cells for 24 and 48 hours in the presence or absence of the antioxidant NAC, using the H2DCFDA labeling assay. Fluorescence microplate reader and microscope prove that the fluorescence intensity is proportional to the duration of the culture, and prove the generation of ROS in a dose and time-dependent manner.

We further observed that the co-exposure of NAC effectively prevented the generation of ROS induced by 100 μg/mL GNP within 24 and 48 hours (Figure 4A and B).

Figure 4 GNP-induced ROS production. (A) Fluorescence image of SH-SY5Y cells treated with 10-100 μg/mL GNP for 24-48 hours and stained with DCFHDA. (B) Percentage of ROS due to GNPs in the cell. SH-SY5Y cells were pretreated with or without NAC (1.5 mM) for 1 hour, and then exposed to GNP (100 μg/mL) for 24 and 48 hours. The images were taken in a phase contrast and fluorescence microscope (Nikon, 80i type). Each value represents the mean ± SE of three experiments. * P<0.01 compared with control. Under the same duration, there was a significant difference between the exposure concentrations of GNPs (100 μg/mL) and GNPs (100 μg/mL) + NAC groups (P<0.01). Abbreviations: DCFHDA, dichlorodihydrofluorescein diacetate; GNP, gadolinium oxide nanoparticles; NAC, N-acetylcysteine; ROS, reactive oxygen species; SE, standard error.

The impact of GNP on MMP

ROS accumulated in SH-SY5Y cells can change mitochondrial permeability and cause MMP to collapse. The effect of GNP on MMP was evaluated in SH-SY5Y cells. The cells were exposed to GNPs (50–100 μg/mL) for 24 and 48 hours, and the uptake of rhodamine-123 was detected using a fluorescence microscope. The decrease in fluorescence intensity in cells exposed to GNP indicates that MMP in SH-SY5Y cells is significantly reduced in a concentration- and time-dependent manner (Figure 5).

Figure 5 Dose and time-dependent mitochondrial membrane potential induced by gadolinium oxide nanoparticles in SH-SY5Y cells.

The activities of LPO, GSH, SOD and CAT were measured in SH-SY5Y cells treated with or without GNP for 48 hours. The cells treated with the negative control were maintained at each time point, and the enzyme activity observed in the GNP-treated cells was expressed as a percentage of the activity relative to the negative control at each time point. GSH levels were significantly reduced in a time- and dose-dependent manner (Figure 6A). Compared with the respective controls, after 24 and 48 hours of GNP treatment, a significant increase in the activities of LPO, SOD and CAT was found in SH-SY5Y cells (Figure 6B-D).

Figure 6 GNP-induced oxidative stress biomarkers (A). Glutathione (B). LPO (C). Superoxide dismutase (D). CAT in SH-SY5Y cells. Each value represents the mean ± SE of three experiments. * P<0.01 compared with control. Abbreviations: CAT, catalase; GSH, glutathione; LPO, lipid peroxide; MDA, malondialdehyde; SE, standard error; SOD, superoxide dismutase.

Chromosome fragmentation and caspase-3 activity

Using Hoechst 33258 staining, SH-SY5Y cell chromosome fragmentation was observed due to GNP exposure (Figure 7A). The activity of caspase-3 increased in a dose- and time-dependent manner (Figure 7B).

Figure 7 Chromosome condensation and caspase-3 activity induction of SH-SY5Y cells exposed to GNP. Note: (A) Chromosome condensation and (B) induction of caspase-3 activity in SH-SY5Y cells 24 and 48 hours after exposure to GNP. Each value represents the mean ± SE of three experiments. * P<0.01 compared with control. Arrows (→) indicate broken chromosomes. Abbreviations: GNP, gadolinium oxide nanoparticles; SE, standard error.

Due to GNP exposure, DNA damage was higher at 100 μg/mL GNP and lasted for 48 hours (Figure 8). At lower concentrations of GNP, there was no significant difference in the amount of DNA damage. The fluorescence photo of SH-SY5Y cell comet electrophoresis is shown in Figure 8.

Figure 8 DNA strand breaks caused by GNP in SH-SY5Y cells (A). % Tail DNA (B). Olive tail moment (C). Control cell (D). Expose the cells to GNP (50 μg/mL) for 48 hours. Each value represents the mean ± SE of three experiments. * P<0.01 compared with control. The scale bar is 50 μm. Abbreviations: GNP, gadolinium oxide nanoparticles; OTM, olive tail moment; SE, standard error.

Bcl-2/Bax mRNA and protein expression ratio

Many molecular factors such as Bcl-2 and Bax play a key role in the execution of apoptosis. We analyzed their expression patterns in SH-SY5Y cells treated with GNP. The Bcl-2 gene family plays an important role in the regulation of apoptosis. Therefore, in order to understand the molecular mechanism of GNP-induced apoptosis of human neuronal cells, we used RT-PCR to analyze the expression levels of Bcl-2 and Bax. The results showed that GNP down-regulated the expression of Bcl-2 mRNA and simultaneously up-regulated the expression of Bax mRNA after 48 hours of incubation (Figure 9C).

Figure 9 Western blot analysis of proteins involved in apoptosis due to GNP exposure for 48 hours. (A) Bax, Bcl2. Beta-actin was used as an internal control to normalize the results. (B) Relative quantification of protein expression level. (C) Quantitative real-time polymerase chain reaction analysis of mRNA levels of apoptosis genes in SH-SY5Y cells exposed to GNP. The results represent the mean ± SE of triplicate experiments. * P<0.01 compared with control. Abbreviations: GNP, gadolinium oxide nanoparticles; SE, standard error.

To confirm the results of quantitative RT-PCR, we used western blotting to further examine the protein expression levels of these genes in GNP-exposed SH-SY5Y cells. Similar to the mRNA results, the protein level of bax was significantly up-regulated, while the expression of bcl-2 was significantly down-regulated in GNP-treated cells (Figure 9A and B).

GNP has been used as a more effective contrast agent in MRI and plays an important role in biomedicine. However, there are few reports on the cytotoxic effects of GNPs on human neuron (SH-SY5Y) cells. This study reports the toxicity mechanism of GNP in SH-SY5Y cells. However, GNP shows some limitations related to its cumulative toxicity. Another toxic mechanism of GNP induces cell death, which is obvious in apoptosis. Zhang et al.16 reported that GNP-treated RAW 264.7 cells increased DNA damage. The ROS generation ability of NPs is related to the cytotoxicity of various cells. 22 The production of ROS and free radicals is one of the important mechanisms of nanoparticle toxicity; this may be the result of oxidative stress and cause cell damage. 23 In this study, after GNP was exposed to SH-SY5Y cells, we found ROS production through H2-DCFDA staining and fluorescence microscopy data.

In addition, MTT and LDH tests showed that GNP in SH-SY5Y cells induces cytotoxicity in a time- and dose-dependent manner. Fu et al.24 reported that the generation of ROS is a mechanism of cytotoxicity. In addition, Yu et al. 25 showed that rare element nanoparticles, including samarium (Sm)/Europium (Eu) and gadolinium (Gd)/terbium (Tb), can induce autophagy in human hepatocytes. Due to oxidative stress damage and activation of senescence, the accumulation of ROS may interfere with cell capabilities. Oxidative stress plays a specific role in the SH-SY5Y cytotoxicity induced by nanoparticles. The ability of nanoparticles to generate ROS is an important biomarker for discovering their toxicity. 26,27 Park and Park28 reported that nanoparticles can generate ROS both in vitro and in vivo. This may be due to their unique physical and chemical properties and their direct or indirect effects on certain organelles of nanoparticles entering cells. Especially due to oxidative damage, mitochondrial dysfunction may be induced. 29 Therefore, our observations indicate that the MMP of SH-SY5Y cells will decrease due to GNP exposure. In this study, we found that GSH in SH-SY5Y cells is depleted due to the damage of GNP to the cellular antioxidant system. From our results, it can be seen that within 48 hours of exposure to 100 μg/mL NPs, the early and late apoptosis rates increased significantly. The results indicate that GNPs exposure may induce death patterns. The above-mentioned apoptosis of ROS cells induced by the mitochondrial pathway is not sufficient to explain the toxic effects of GNPs exposure. It seems that there are other mechanisms to consider. It can be used as one of the cytotoxic mechanisms of SH-SY5Y cells and GNP exposure.

ROS is considered to be a signal molecule that initiates and executes the death program of apoptotic cells. 30 In particular, the production of ROS is also related to programmed cell death in many situations, such as stroke, inflammation, ischemia, and lung 31,32 In this study, we observed the GDP in use. Gopinath et al33 reported that bax was upregulated by p53. The attachment of bax to the mitochondrial membrane may cause p53-mediated apoptosis. Caspase is activated in the process of apoptosis in many cells, and is known to play a vital role in the initiation and execution of apoptosis. According to reports, activated caspase-3 (cleaved caspase-3) is essential for cell DNA damage and cell apoptosis. 34 In summary, the upregulation of p53 leads to the activation of pro-apoptotic members of the bcl-2 family (such as bax) and induces permeabilization of the outer mitochondrial membrane, releasing soluble proteins from the interstitial space into the cytoplasm, where they promote caspase activation. 35 Once activated, caspase-9 continues to activate caspase-3 (effector caspase), cleaving the substrate at aspartic acid residues. This activation of proteolytic activity seems to be an event of apoptosis. 36

GNPs induce the cytotoxicity of SH-SY5Y cells in a dose- and time-dependent manner, which may be mediated by ROS production. The decrease of MMP and the simultaneous up-regulation of bax/bcl2 gene expression indicate that GNP induces SH-SY5Y cell apoptosis through the mitochondrial pathway. Our study of acute exposure to high-level stimuli of GNP apoptotic response requires further research to determine whether the application of GNP may have long-term exposure consequences.

The author sincerely thanks the Dean of the Institute of Science at King Saud University for funding this research through the research group project No RGP-180.

All authors contributed to data analysis, drafting and revision of the paper, and agreed to be responsible for all aspects of the work.

The authors report no conflicts of interest in this work.

Caruthers SD, Wickline SA, Lanza GM. The application of nanotechnology in medicine. Curr Opin Biotechnology Company. 2007;18(1):26-30.

Kumar C, editor. Nanomaterials for medical diagnosis and treatment. Weinheim: Wiley-VCH; 2007.

Gao X, Cui Y, Levenson RM, Chung LW, Nie S. In vivo cancer targeting and semiconductor quantum dot imaging. Nat Biotech. 2004;22(8):969-976.

Hedlund A, Ahren M, Gustafsson H, etc. Gd2O3 nanoparticles are used for MRI contrast enhancement in hematopoietic cells. International J Nanomedicine. 2011; 6: 3233-3240.

Olson ES, Jiang T, Aguilera TA, etc. The activatable cell-penetrating peptide is connected to the nanoparticle as a dual probe for protease in vivo fluorescence and MR imaging. Proc Natl Acad Sci US A. 2010;107(9):4311–4316.

Dixit S, Das M, Alwarappan S, etc. Phospholipid micelles for imaging and gene delivery encapsulate gadolinium oxide nanoparticles. RSC Advanced 2013; 3(8): 2727–2735.

Markman P, Skov L, Rosen K, etc. Renal systemic fibrosis: suspected pathogenic effects of gadolinium diamine for contrast-enhanced magnetic resonance imaging. J Am Soc Nephrol. 2006;17(9):2359–2362.

Fischer HC, Chen WCW. Nano toxicity: There is a growing demand for in vivo research. Curr Opin Biotechnol. 2007;18:565-571.

Babic-Stojic B, Jokanovic V, Milivojevic D, etc. NMR relaxation properties and cytotoxicity of Gd2O3 nanoparticle suspensions in organic liquids. J Nanop Res. 2014; 16: 2663.

Durocher Y, Butler M. Expression system for therapeutic glycoprotein production. Curr Opin Biotechnol. 2009;20(6):700–707.

Alarifi S, Ali D, Alkahtani S. Nanoalumina induces apoptosis by damaging the antioxidant enzyme system in human liver cancer cells. International J Nanomedicine. 2015; 10: 3751-3760.

Hanahan D, Weinberg RA. Sign of cancer. cell. 2000;100(1):646–674.

Unfried K, Albrecht C, Klotz LO, Mikecz A, Grether-Beck S, Schins RPF. Cellular response to nanoparticles: target structure and mechanism. J Nano Toxicology. 2007; 1:52-71.

Mosmann T. Rapid colorimetric analysis of cell growth and survival: application in proliferation and cytotoxicity analysis. J Immunological methods. 1983; 65(1-2): 55-63.

Zhou Yujie, Zhang SP, Liu CW, Cai Yuqing. Selenium protects ROS cells from apoptosis induced by cadmium-induced mitochondrial dysfunction in LLCPK (1) cells. In vitro toxicology. 2009;23(2):288-294.

Zhang X, Chibli H, Mielke R, Nadeau J. Ultra-small gold-adriamycin conjugate quickly kills anti-apoptotic cancer cells. Bioconjug Chemistry 2011;22(2):235–243.

Singer NP, McCoy MT, Tice RR, Schneider EL. A simple technique to quantify low-level DNA damage in a single cell. Exp Cell Res. 1988;175(1):184-191.

Anderson D, Yu TW, Philips BJ, Schmerzer P. In the COMET test, the effects of various antioxidants and other modifiers on DNA damage caused by oxygen free radicals in human lymphocytes. Mutant Reservoir. 1994;307(1):261-271.

Tice RR, Agurell E, Anderson D, etc. Single cell gel/comet test: a guide for in vitro and in vivo genetic toxicology testing. Environmental molecular mutagens. 2000;35(3):206-221.

Bradford MM. A fast and sensitive method that uses the principle of protein-dye binding to quantify microgram-level proteins. Anal biochemistry. 1976; 72: 248-254.

Livak KJ, Schmidtgen TD. Use real-time quantitative PCR and (2CT) methods to analyze relevant gene expression data. method. 2001;25(4):402–408.

Buyukhatipoglu K, Klein AM. Superparamagnetic iron oxide nanoparticles change the morphology and mechanics of endothelial cells through the formation of reactive oxygen species. J Biomed Mater Res A. 2011;96(1):186-195.

Nel A, Xia T, Madler L, Li N. Potential toxicity of nano-scale materials. science. 2006;311(5761):622-627.

Fu PP, Xia Q, Hwang HM, Ray PC, Yu H. The mechanism of nano-toxicity: the production of reactive oxygen species. J Food drug anus. 2014;22(1):64-75.

Yu L, Lu Y, Man N, Yu SH, Wen LP. Rare earth oxide nanocrystals induce autophagy in HeLa cells. small. 2009;5(24):2784–2787.

Foucaud L, Wilson MR, Brown DM, Stone V. Measure the active substances produced by nanoparticles prepared in biologically relevant media. Toxicology Wright. 2007;174(1-3):1-9.

Xia T, Kovochich M, Brant J, etc. According to the oxidative stress paradigm, the ability of environmental and artificial nanoparticles to induce cytotoxicity is compared. Nanolet. 2006;6(8):1794–1807.

Park EJ, Park K. Silica nanoparticles induce oxidative stress and pro-inflammatory responses in vivo and in vitro. Toxicology Wright. 2009;184(1):18-25.

Guo C, Sun L, Chen X, Zhang D. Oxidative stress, mitochondrial damage and neurodegenerative diseases. Nerve regeneration resources. 2013;8(21):2003-2014.

Ott M, Gogvadze V, Orrenius S, Zhivotovsky B. Mitochondria, oxidative stress, and cell death. Apoptosis. 2007;12(5):913-922.

Kannan K, Jain SK. Oxidative stress and apoptosis. Pathophysiology. 2000;7(3):153–163.

Bai J, Meng Z. The effect of sulfur dioxide on the expression of apoptosis-related genes in rat lung cells. Regul Toxicol Pharmacol. 2005;43(3):272-279.

Gopinath P, Gogoi SK, Sanpui P, Paul A, Chattopadhyay A, Ghosh SS. The signal gene cascade in silver nanoparticles induces apoptosis. Colloidal surfing B biological interface. 2010;77(2):240–245.

Janicke RU, Sprengart ML, Wati MR, Porter AG. Caspase-3 is required for DNA fragmentation and morphological changes associated with apoptosis. J Biochemistry. 1998; 273(16): 9357-9360.

Fuentes-Prior P, Salvesen GS. Shape the protein structure of caspase activity, specificity, activation and inhibition. J Biochemistry. 2004;384(Pt 2):201-232.

Youle RJ, Strasser A. The BCL-2 protein family: an oppositional activity that mediates cell death. Nat Rev Mol Cell Biology. 2008;9(1):47–59.

This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.com/terms.php and include the Creative Commons Attribution-Non-commercial (unported, v3.0) license. By accessing the work, you hereby accept the terms. The use of the work for non-commercial purposes is permitted without any further permission from Dove Medical Press Limited, provided that the work has an appropriate attribution. For permission to use this work for commercial purposes, please refer to paragraphs 4.2 and 5 of our terms.

Contact Us• Privacy Policy• Associations and Partners• Testimonials• Terms and Conditions• Recommend this site• Top

Contact Us• Privacy Policy

© Copyright 2021 • Dove Press Ltd • Software development of maffey.com • Web design of Adhesion

The views expressed in all articles published here are those of specific authors and do not necessarily reflect the views of Dove Medical Press Ltd or any of its employees.

Dove Medical Press is part of Taylor & Francis Group, the academic publishing department of Informa PLC. Copyright 2017 Informa PLC. all rights reserved. This website is owned and operated by Informa PLC ("Informa"), and its registered office address is 5 Howick Place, London SW1P 1WG. Registered in England and Wales. Number 3099067. UK VAT group: GB 365 4626 36

In order to provide our website visitors and registered users with services that suit their personal preferences, we use cookies to analyze visitor traffic and personalize content. You can understand our use of cookies by reading our privacy policy. We also retain data about visitors and registered users for internal purposes and to share information with our business partners. By reading our privacy policy, you can understand which of your data we retain, how to process it, with whom to share it, and your right to delete data.

If you agree to our use of cookies and the content of our privacy policy, please click "Accept".